Alle offentlige logger
Hopp til navigering
Hopp til søk
Kombinert visning av alle loggene på Bitraf. Du kan minske antallet resultater ved å velge loggtype, brukernavn eller den siden som er påvirket (husk å skille mellom store og små bokstaver).
- 7. aug. 2016 kl. 16:54 Jarlemag (diskusjon | bidrag) lastet opp Fil:I016 Biophotometer.jpg (Eppendorf Biophotometer 6131.)
- 24. jul. 2016 kl. 21:15 Jarlemag (diskusjon | bidrag) lastet opp Fil:July11PCRresult.jpg (The result after electrophoresis of the PCR samples from the meetup. Unfortunately, the results were rather disappointing. Out of the six PCR reactions, it appears that only one resulted in succesful amplification. Sample 5, using 1 uL of the solution...)
- 19. jul. 2016 kl. 06:06 Jarlemag (diskusjon | bidrag) lastet opp Fil:Microwave.jpg (Microwave oven for lab use.)
- 19. jul. 2016 kl. 00:44 Jarlemag (diskusjon | bidrag) lastet opp Fil:Pipettes.jpg (Set of micropipettes; 1-10, 10-100 and 100-1000 uL. LHP brand (Liquid Handling Products).)
- 19. jul. 2016 kl. 00:34 Jarlemag (diskusjon | bidrag) lastet opp Fil:Electrophoresis.jpg (Electrophoresis equipment: Carolina deluxe gel chamber and BioRad PowerPac power supply. Bottles with 10x TAE buffer and electrophoresis-grade agarose (small bottle) are also visible.)
- 19. jul. 2016 kl. 00:28 Jarlemag (diskusjon | bidrag) lastet opp Fil:OpenPCR.jpg (OpenPCR thermocycler.)
- 19. jul. 2016 kl. 00:20 Jarlemag (diskusjon | bidrag) lastet opp Fil:Bitraf PCR ITS1 ITS4 july 10.jpg (Result of shortened PCR program july 10, using 30 cycles for amplification with primers ITS1 and ITS4 and same template as prepared July 5 (stored in freezer). From left to right: DSBio 1kb ladder (5 uL), PCR sample using 1 uL template (10 uL), PCR sam...)
- 7. jul. 2016 kl. 05:53 Jarlemag (diskusjon | bidrag) lastet opp Fil:YeastPCR ITS ITS4 050716.jpg (Result from PCR experiment to copy the 5.8S rRNA gene RDN58 and flanking ITS regions from yeast (S. cerevisae). Primers used were ITS1 and ITS4. From left: DSBio 1kb ladder (5 uL), DSBio 50bp ladder (5 uL), PCR sample 1 (10 uL), PCR sample 2 (10 uL), P...)
- 2. jul. 2016 kl. 23:25 Jarlemag (diskusjon | bidrag) lastet opp Fil:RDN582-region.png (Representation of the yeast genome region centered on the RDN58-2 rRNA gene, as shown in the SGD genome browser using the latest version of the S. cerevisae S288C genome (assembly R64). The S. cerevisae genome contains 100-200 repeats of the genes show...)
- 2. jul. 2016 kl. 19:39 Jarlemag (diskusjon | bidrag) lastet opp en ny versjon av Fil:ITS1 ITS4 insilico UCSC.png (Redid cropping to include full sequence of first result.)
- 2. jul. 2016 kl. 19:35 Jarlemag (diskusjon | bidrag) lastet opp en ny versjon av Fil:ITS1 ITS4 insilico UCSC.png (Cropped picture.)
- 2. jul. 2016 kl. 18:55 Jarlemag (diskusjon | bidrag) lastet opp Fil:ITS1 ITS4 S288C BLAST result.png (Graphic representation of result returned from BLAST search showing the location of the PCR target regions for the ITS1 and ITS4 primers in the S. cerevisae S288C genome (assembly R64, GenBank accession GCA_000146045.2). The query sequence is the expec...)
- 2. jul. 2016 kl. 12:45 Jarlemag (diskusjon | bidrag) lastet opp Fil:ITS1 ITS4 insilico UCSC.png (Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer...)
- 28. jun. 2016 kl. 18:55 Jarlemag (diskusjon | bidrag) lastet opp Fil:Dsc 0069.jpg (Resultat av gel-elektroforese som demonstret på meetup 27.06.16. Sport #1 og 4-7 fra venstre: Dongsheng Biotech 1kb ladder (~5 uL). Spor 2,3 og 8: Dongsheng Biotech 50bp ladder (~5 uL). Bildet er tatt av Heikki Sørum.)