Alle offentlige logger
Hopp til navigering
Hopp til søk
Kombinert visning av alle loggene på Bitraf. Du kan minske antallet resultater ved å velge loggtype, brukernavn eller den siden som er påvirket (husk å skille mellom store og små bokstaver).
- 2. jul. 2016 kl. 19:39 Jarlemag (diskusjon | bidrag) lastet opp en ny versjon av Fil:ITS1 ITS4 insilico UCSC.png (Redid cropping to include full sequence of first result.)
- 2. jul. 2016 kl. 19:35 Jarlemag (diskusjon | bidrag) lastet opp en ny versjon av Fil:ITS1 ITS4 insilico UCSC.png (Cropped picture.)
- 2. jul. 2016 kl. 12:45 Jarlemag (diskusjon | bidrag) lastet opp Fil:ITS1 ITS4 insilico UCSC.png (Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer...)
