Fil:ITS1 ITS4 insilico UCSC.png

Fra Bitraf
Revisjon per 2. jul. 2016 kl. 13:45 av Jarlemag (diskusjon | bidrag) (Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer...)
(diff) ← Eldre revisjon | Nåværende revisjon (diff) | Nyere revisjon → (diff)
Hopp til navigering Hopp til søk
Opprinnelig fil(797 × 898 piksler, filstørrelse: 92 KB, MIME-type: image/png)

Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer_Apr2011/sacCer3) genome assembly as the template.

The result shows two expected PCR products/target regions with identical sequences. For each, the line starting with a > specifies the target location in the assembly, the target region size/expected product size, and the primer sequences, separated by spaces. The subsequence lines show the target region/expected product sequence, with the sequence of the first (FWD) primer in capitals.

The target region size/expected product size (841bp) includes the primers.

Filhistorikk

Klikk på et tidspunkt for å vise filen slik den var på det tidspunktet.

Dato/klokkeslettMiniatyrbildeDimensjonerBrukerKommentar
nåværende2. jul. 2016 kl. 20:39Miniatyrbilde av versjonen fra 2. jul. 2016 kl. 20:39797 × 898 (92 KB)Jarlemag (diskusjon | bidrag)Redid cropping to include full sequence of first result.
2. jul. 2016 kl. 20:35Miniatyrbilde av versjonen fra 2. jul. 2016 kl. 20:35801 × 903 (81 KB)Jarlemag (diskusjon | bidrag)Cropped picture.
2. jul. 2016 kl. 13:45Miniatyrbilde av versjonen fra 2. jul. 2016 kl. 13:451 152 × 959 (131 KB)Jarlemag (diskusjon | bidrag)Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer...
  • Du kan ikke overskrive denne filen.

Den følgende siden bruker denne filen:

Metadata