Fil:ITS1 ITS4 insilico UCSC.png
Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer_Apr2011/sacCer3) genome assembly as the template.
The result shows two expected PCR products/target regions with identical sequences. For each, the line starting with a > specifies the target location in the assembly, the target region size/expected product size, and the primer sequences, separated by spaces. The subsequence lines show the target region/expected product sequence, with the sequence of the first (FWD) primer in capitals.
The target region size/expected product size (841bp) includes the primers.
Filhistorikk
Klikk på et tidspunkt for å vise filen slik den var på det tidspunktet.
| Dato/klokkeslett | Miniatyrbilde | Dimensjoner | Bruker | Kommentar | |
|---|---|---|---|---|---|
| nåværende | 2. jul. 2016 kl. 19:39 | | 797 × 898 (92 KB) | Jarlemag (diskusjon | bidrag) | Redid cropping to include full sequence of first result. |
| 2. jul. 2016 kl. 19:35 |  | 801 × 903 (81 KB) | Jarlemag (diskusjon | bidrag) | Cropped picture. | |
| 2. jul. 2016 kl. 12:45 |  | 1 152 × 959 (131 KB) | Jarlemag (diskusjon | bidrag) | Screenshot of in silico PCR result using the UCSC in silico PCR tool (https://genome.ucsc.edu/cgi-bin/hgPcr) with the primer sequences ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5' TCCTCCGCTTATTGATATGC 3'), selecting the S. cerevisae April 2011 (SacCer... |
- Du kan ikke overskrive denne filen.
Filbruk
Den følgende siden bruker denne filen:
