Vis kilden til BioHackerLab/Experimental


Experiments performed at Bitraf.


=05 Jul 2016 - Bitraf PCR #1=

[[Fil:YeastPCR ITS ITS4 050716.jpg|miniatyr|sentrer|Result from PCR experiment to copy the 5.8S rRNA gene RDN58 and flanking ITS regions from yeast (S. cerevisae). Primers used were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). Primers were supplied by Macrogen Inc. Primer target concentration: 0.5 uM each. From left: DSBio 1kb ladder (5 uL), DSBio 50bp ladder (5 uL), PCR sample 1 (10 uL), PCR sample 2 (10 uL), PCR negative control (no template) sample (~5-10 uL). Electrophoresis at 75V for ~45 min on 1 % agarose with GelGreen DNA stain. Visualized with DarkReader DR22 transilluminator. PCR performed 05.07.16 with OpenPCR and DongSheng Biotech Taq mix. Reaction volume 50 uL. Template source is store bought dry yeast (Idun tørrgjær). Template source was prepared by dissolving 0.1 g dry yeast in 10 mL distilled water, and incubating 50 uL of the resulting yeast solution in a PCR tube at 98C for 10 min in openPCR. For PCR sample 1 and 2, 1 uL and 2 uL of the supernatant after incubation was added to the reaction mix, respectively. PCR program was as follows: Initital denaturation: 94C for 3 min. Repeated cycles: Denaturation: 94C for 30s.  Anneal: 55.5C for 30s. Extension: 72C for 1 min. Final extension: 72C for 10 min. 35 cycles. Total run time: ~2h 20 min. ]]

=10 Jul 2016 - Bitraf PCR #2=

[[Fil:Bitraf PCR ITS1 ITS4 july 10.jpg|miniatyr|Result of shortened PCR program july 10, using 30 cycles and no final extension step for amplification with primers ITS1 and ITS4 and same template as prepared July 5 (stored in freezer). From left to right: DSBio 1kb ladder (5 uL), PCR sample using 1 uL template (10 uL), PCR sample using 2 uL template (10 uL), negative control PCR sample (no template) (10 uL). For the second PCR sample, no PCR product band is visible and the reaction appears unsuccesful.|sentrer]]

=11 Jul 2016 - Bitraf PCR #3=

PCR was performed using the same PCR setup and program as July 10 except for the selection of templates and template amounts. The following templates and template amounts were used:

* #1/HS1A: 1 uL yeast sample #1. (S. Cerevisiae [1])
* #2/HS1B: 2 uL yeast sample #1. (S. Cerevisiae [1])
* #3/HS2A: 1 uL yeast sample #2. (Brettanomyces? [1])
* #4/HS2B: 2 uL yeast sample #2. (Brettanomyces?[1])
* #5/P1: 1 uL S. cerevisiae (Idun tørrgjær. Template prepared 5 july stored in freezer) 
* #6/P2: 2 uL S. cerevisiae (Idun tørrgjær. Template prepared 5 july stored in freezer)
* #7/NT: Reaction mix and primers only, no template.

The PCR samples were moved to freezer after completion of the PCR run.

[1]: Liquid cultures provided by Heikki. To prepare template, 50 uL liquid culture was incubated at 98C for 10 min in OpenPCR.

[[Fil:July11PCRresult.jpg|miniatyr|sentrer|The result after electrophoresis of the PCR samples from the meetup 11 july 2016. Unfortunately, the results were rather disappointing. Out of the six PCR reactions, it appears that only one resulted in succesful amplification. Sample 5, using 1 uL of the solution previously prepared from dry baker's yeast as template, gave the expected band. There are several possible explanations for the failure of the other reactions to produce visible bands, including differences in template preparation, amount of template used and genetic differences between the yeast types. From left to right: DSbio 1kb ladder, PCR samples #1 , 2, 3, 4, 5, 6 and 7 (negative control). Electrophoresis was performed with 1% agarose at 100 V for 30 min.]]

==Expected results/bioinformatics analysis==

'''Reference sequence:'''

One of the yeast samples was described as Brettanomyces. The most relevant organism in this genus appears to be Brettanomyces bruxellensis. The organism overview page at http://www.ncbi.nlm.nih.gov/genome/11901 lists  Brettanomyces bruxellensis CBS 2499 (assembly Dekkera bruxellensis CBS 2499 v2.0, Assembly accession no. GCA_000340765.1) as the representative genome for this organism.

'''BLAST search:'''

A BLAST search was performed in the GCA_000340765.1 assembly with the expected PCR product sequence  for amplification with primers ITS1 and ITS4 from S. cerevisiae, as determined by in silico PCR ([https://genome.ucsc.edu/cgi-bin/hgPcr?hgsid=500810913_rmZAxNnexxkDaK66dHwLt86MeALA&org=S.+cerevisiae&db=sacCer3&wp_target=genome&wp_f=TCCGTAGGTGAACCTGCGG&wp_r=TCCTCCGCTTATTGATATGC&Submit=submit&wp_size=4000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0 link]). The search returned 15 hits ("Sequences producing significant alignments". The longest 100% matching sequence stretch was 17 bp long, having an Expectation value ("E value"; roughly, the expected number of identical results encountered by chance) of 5.1. The hit with lowest Expectation value and the only hit with an E value below 1, is a 34bp stretch with 28/34(82%) matching nucleotides and an E value of 0.42.

Likewise a blastn search was performed with the ITS1 primer sequence as query. The search returned 194 hits and 94 sequences producing significant alignments. Several hits had 100% query coverage and 100% identity. However, the lowest E value reported was 25. Search with megablast/discontigous megablast did not return any hits.

Finally, a blastn search was likewise performed with the reverse complement of the ITS4 primer sequence. The search returned 200 hits and 100 sequences producing significant alignments, including several hits with 100% query coverage and 100% identity. The lowest E value was 0.49.